And the winners are…

And the first Nobel Prize of the year has been awarded! This year, the Nobel Prize for Medicine and Physiology has been awarded to Sir John B Gurdon and Shinya Yamanaka for

“for the discovery that mature cells can be reprogrammed to become pluripotent”

So what does this mean?

All cells in the human body originate from stem cells, but what is a stem cell?

The scientific definition of a stem cell, is a cell that is capable of producing another stem cell, and a less potent progenitor. This means that when it divides,  it produces another stem cell like itself, and another cell which has less potential in what sort of cells it can divide into.

When the fertilised egg which was going to develop into the human being you now call yourself first started dividing, it divided into a population of stem cells. These stem cells had the capability to become any cell in the human body. The name for this capability in a stem cell is ‘totipotent’. The same stem cell could have produced a neuron, or a sperm cell, or a white blood cell. The precise, local chemical environment of the stem cell then caused it to specialise into a different, more restricted stem cell. This stem cell could perhaps only form different cells from the same organ, like the different types of neuron or glia which make up the brain. These stem cells, in response to their chemical microenvironment, would have divided and divided, and become progressively more and more restricted in their cell-producing potential that we end up losing the all-producing-stem-cells from our embryonic phase.

As the above diagram shows, there are many different types of stem cell, and they fall into different levels of the potency heirarchy depending on how far along development the organism is;

  • Totipotent - The first stem cells formed from the fertilised egg are totipotent stem cells. These are capable  of producing any cell in the body - both embryonic cells and non embryonic cells.
  • Pluripotent - The majority of the totipotent stem cells eventually become slightly more restricted in their cell-making potential. Pluripotent stem cells can produce most cells in the body, but no embryonic cells.
  • Multipotent - From pluripotency, the potential becomes even more restriced. Multipotent stem cells can produce cells of a particular type of tissue. Like neural stem cells can produce any of the many different types of cell present in the nervous system, but they can’t produce cardiac muscle cells
  • Unipotent - Are the most restricted type of stem cell. Unipotent stem cells can only generate one type of cell, but are regarded as stem cells as they can produce other unipotent stem cells.

Fast forward to adulthood and you have probably lost the vast majority of all your totipotent and pluripotent stem cells. Each organ will have a limited supply of local stem cells, likely multi- or unipotent, to allow for limited regeneration of cells.

Pretty much all of our cells contain the same DNA. Yet they are different. How does a stem cell become more restricted in what it can produce?

It’s done by genetic switches. All cells in the human body will contain the same genetic information (barring the egg and sperm, but they’re special), but will be vastly differ from one another. Look at neurons and muscle fibres, for example. This is achieved by expressing a particular pattern of genes. Some genes are switched off, and some genes are switched on. This produces various patterns of genetic expression, and it is this which produces the distinct cells which construct our various tissues and organs.

Different types of muscle fibre and neuron. All originate from the same totipotent stem cells, all contain the same DNA (within the same organism). In each different cell, different genes are switched on and different genes are switched off. these switches were determined by specific chemical signals in their microenvironment during their production from stem cells.

The original totipotent stem cells in the embryo would have responded to chemical cues in their microenvironment which would have signaled for them to change into more restricted pluripotent stem cells. These pluripotent stem cells would then have responded to different chemical cues to become even more restricted multipotent stem cells, and so on. The chemical cues would bind to receptors on the surface of the cells (or receptors within the cells), and these receptors would have signalled to the cell to switch on certain genes, and switch off other genes - producing the correct genetic pattern for that time and place. 

A. Are different types of chemical cues; B. Is a receptor; C. Is the Cell; D. The Nucleus; E. The genetic material within the nucleus, aka the DNA.

The diagram shows how chemical cues can induce genetic changes. They can bind to the receptor, and the receptor initiates a cascade of biochemical pathways within the cell to affect the genes, OR the chemical signals can pass through the cell membrane and directly affect the DNA itself.

With regards to the nobel prize, these scientists figured out how to reverse engineer these signals to turn restricted cells back into pluripotent cells - potentially allowing us to generate helpful stem cells from any other cell in our body. Stem cells can be hard to come by, but now with a method to actually produce them in the laboratory from easily obtained resources, we’re on track to better understand debilitating disease processes, and may even be able to adapt this technology for use in regenerative medicine.

Congratulations, guys! Well deserved!

MOAR KNOWLEDGE

I see! Thank you for the extra information. This is most interesting. A quick scan of the literature indicates that it doesn’t link in with classical psychotic symptoms. A recent(-ish) review by S Szara (2007) says current evidence does not suggest it to be a ‘schizotoxin’ (substance which induces schizophrenia). It would be unlikely that any single compound would cause schizophrenia as it is a disorder of such heterogeneous presentation, and the byproduct of many smaller dysfunctional systems. However, it’s role as a neuromodulator (a substance which modifies neuronal communication) is currently being explored so if one really wanted to explore it’s links with psychosis, it may still have a potentiating effect. 

There appears to be a correlation with hyperactivity scores for autism spectrum disorder, interestingly enough. Hyperactivity is part of the positive symptoms of schizophrenia, so there may be something there? But it’s only a correlation. Gotta remember that correlation does not necessitate causation. But point taken about its atypical psychotomimetic effects, I really appreciate the feedback! :D

Peer to peer review on tumblr. A social media parallel to how science works! 

It’s a good day to study transgenics

By the lakeside on campus on this rather fine day, revising various methods of generating transgenic animals. The goose and the fly decided they wanted in on this knowledge too. 

THIS. is very exciting. Title is slightly misleading - the gene (Npas4) putatively responsible for controlling memory formation still needs more testing to determining the extent of its memory control, and I would imagine there’s a bit more to it than the single gene. Perhaps there’s a couple of other genes that have similar function, we’ll have to see.

But it’s opened more doors, now scientists have a better idea of where to look. It certainly is the first cast iron evidence for a single gene being responsible for forming memories.

From the link-

 “This is a gene that can connect from experience to the eventual changing of the circuit,”

-

“We’re hunting for the memory, and we think we can use Npas4 to mark where it is…..That’s because it’s turned on specifically and now we can label the cells and maybe fish out where in the brain the memory is sitting.”

-

Code copying

It’s a basic idea in biology that one cell will initially divide to provide two identical cells (mitosis). These cells will both contain the the same DNA (as long as no mutations have occurred).

Cell division. 2 cells from 1.

If a cell is going to divide, it is going to need to double the amount of DNA it contains, so both of the subsequent cells can each have a full complement of chromosomes. Enter: DNA replication.

DNA replication is a crucial process in maintaining and propagating all known life. It is a complex process which has been conserved throughout most organisms on Earth. DNA replication relies on tiny, miniscule molecular machines built up of many protein sub-units which zip along the chromosomes, forming a copy of the existing DNA. The existing DNA which is being copied can be seen as a template.

The machinery which replicates our DNA is a marvel of evolutionary engineering, but before we go into how this nano-machine works, let’s just look at the very basics of DNA structure.

The double helix, ladder-like structure of DNA

DNA can be seen to have a ladder structure. It is built up of sequences of four bases; guanine (G), cytosine (C), adenine (A) and thymine (T). In a single strand of DNA, you’ll have a long stretch of bases that will read something like GCAATTTGCAATTTAACC, and this is what makes up your genetic code. DNA is double stranded, as the above diagram shows. The opposing strand will contain the complementary bases - forming a base pair system. Each base can only pair with one other base (in DNA). Guanine should only pair with Cytosine. Adenine should only pair with Thymine (the diagram below illustrates base pairing in double stranded DNA). In this way, the two strands of DNA are highly specific and parallel each other in their genetic code. This is important during replication as it determines how the two subsequent DNA strands formed following DNA replication are going to be identical to the parent strand from which they are initially derived.

Semi-conservative replication of DNA. The two single parent strands are conserved, and form the templates of the two new DNA double helices being formed. Each parent strand is conserved to provide the template onto which the complementary bases can be paired up and used to synthesise the complementary strand. Also, note the base pairing between strands.

Replication can only occur in one direction up the DNA strand. It has to start from where the phosphate end marks the ‘front’ end of the strand (referred to as the 5’ end), and go in the direction of where the hydroxyl groups mark the terminal ‘end’ of the strand (referred to as the 3’ end), the diagram below depicts this rather nicely. The two strands that make up a DNA helix are anti-parallel, so the the strands are actually going in opposite directions meaning that replication has to kinda occur in two directions at the same time.

The anti-parallel structure of DNA. Note the positions of the 5’ and the 3’ ends, and how they’re going in opposite directions.

DNA replication is referred to as semi-conservative as each of the subsequent daughter DNA double helices yielded from the parent DNA contain one strand which is one of the single strands from the DNA (hence the ‘conserved’ title) and the other strand is the newly formed strand - so the new strands are only kinda conservative of the old molecule that existed… therefore semi-conservative. The conserved parents strands act as the templates for the synthesis of a new DNA strand to complement the base sequence on each strand - which is why the specific base-pairing is important. This specific base-pairing ensures that the DNA sequence stays the same with every replication.

RIGHT. Crash course in DNA basics out of the way, I can get onto what I actually wanted to explain in this post - the machinery which actually replicates DNA, aka the DNA POLYMERASE ENZYME.

What makes the DNA polymerase enzyme all the more amazing is the fact that it is a tiny, miniscule, little machine assembled from many smaller components - each subunit is synthesised separately from separate genes. The protein products then are assembled to form this final little machine, termed the ‘holoenzyme’. At its heart, DNA polymerase reads the single stranded template and adds the appropriate bases to complete the double strand structure.

Cast yer eyes on this beeeaauuty. The DNA polymerase enzyme in all its’ diagrammatic glory. Each individual protein sub-unit is assigned a different greek letter, and performs it’s own function in the grand replication machine.

Image from ‘Biochemistry’, Stryer et al, 6th Ed.

  • Helicase -Zips along ahead of the holoenzyme unzipping the double stranded DNA into two separate strands. The exposed single strands are coated with SSBP (single stranded binding protein, not shown on diagram) which prevents the single strands from annealing with other single strands (or even with themselves, as they can do).
  • α - The α subunit is the actual site of DNA synthesis. It receives individual bases and arranges them to complement the template strand to form the final double strand.
  • β - The β subunit is the ‘sliding clamp’. This ring structure actually holds the polymerase onto the single strand of DNA so it can slide along, and not float off into the cytosol.
  • γττδδ’ - These 5 subunits come together to make a larger subunit which loads the sliding clamp onto the template strand.
  • ε and θ - These subunits are involved in proofreading the newly formed strand of DNA, to ensure there are no mistakes in the code. They detect this by checking for mismatches in the base pairing with the template strand. In some polymerases, they can go back and delete the mistake to allow the α subunit to rewrite that region of DNA again. Some DNA polymerases in some organisms lack proofreading ability. These organisms have a higher incidence of mistakes in their DNA, thus a higher incidence of mutations. Proofreading DNA is slower at polymerising DNA than non-proofreading polymerase. Still though, it’s not a perfect machine, even with proofreading it still makes the odd mistake - aiding mutation driven evolution, unless it creates a silent or lethal mutation.
  • Other enzymes involved in replication include topoisomerases and ligases, which are also vital to DNA replication.

We need to remember that this machine is incredibly tiny. It is a machine at the chemical level, you need to use powerful Atomic Force Microscopy to view even a fuzzy image of the basic ultrastructure of this enzyme.

Atomic Force Micrograph of DNA polymerase on DNA. Image from Park Systems, a nanotech company.

The actual process by which this enzyme replicates DNA is a complex mechanism, which involves looping DNA round to form a trombone like structure, as a result of discontinuous replication, but that’ll probably be another subject for another post.

DNA replication is a process that is going on in, or has gone on, in every single cell that has ever divided - basically, every organism that has reproduced. This complex, beautiful process, occurring in every organism from the mighty blue whale to the seemingly-boring lichen. A unifying chemical mechanism linking all organisms on the molecular level - evidence of our shared heritage. The enzyme exists in variants across the living world, but at its heart it keeps the basic structure and function. Nature has copied its ability to copy rather well. 

Too much life: 2

 All of the aforementioned characteristics (in part 1) are acquired through mutations and DNA damage in normal genes which perform a more regulated version of the cancerous characterisitic being produced. In this way, a cell requires an accummulation of a few mutations before it will become fully cancerous. As a result, the incidence of cancers increases in older age groups. The longer one lives, the more likely one is to develop a cancer - due to the accumulation of DNA damage or mutations one will aquire through their lifetimes due to lifestyle, environment and plain-old-faulty genetics. The body has mechanisms to detect and eliminate cancer cells, as the immune system can be rather effective. But some kind of immunocompromise can open up a window for a cancer cell to go forth and spread its progeny. Either this, or additional mutations apart from these basic 6+, can make a cancer cell that much more potent and resistant to bodily defences. For the metastasis characteristic, a cell would require more than just a single mutation, as this is a product of a few mechanisms. In total, I would say a ballpark figure of at least 10 mutations would make a cell malignant. Due to genetic-mistake-correction mechanisms, a single cell accummulating 10 mutations in precisely the right genes, even in the presence of carcinogens, would be unlikely. This alone wouldn’t explain the massive prevalence of cancer in modern society.

I plucked this little statistic from my introductory lecture on Cancer

 What seems to be the case is an initial genetic instability event - A disruption in a common pathway in all cancers which opens up the genome to become mutation prone. The evidence and data suggest that this is due to the p53 pathway within cells. Disrupt this, and the basic mutations will be much much more likely to follow. p53 is a special, vital protein within cells, and is also referred to as ‘The Guardian of the Genome’ due to its ability to sense DNA damage, and decide whether it can be fixed, or if the cell should apoptose, amongst other responses to cell stress. But, an entire post could be written on p53 and still barely scratch the surface. So we’ll leave p53 at that for now. Suffice to say, p53 dysfunction is a major player in cancer, and currently is linked to over 50% of human cancers (and maybe even more).

The big white blobby structure represents the p53 protein. It’s a protein that can carry out many functions within the cells. Here, it is binding DNA to activate gene expression.

To this point, smoking over ones lifetime induces many mutations in DNA, and disrupts cellular function, increasing the liklihood of this complement of mutations - and much more - thus producing devastating lung cancers. The lungs feel the brunt of the high energy carcinogenic agents from the cigarette smoke, leading to the accummulation of more than just the basic 6 mutations, producing elaborate and ‘intelligent’ cancer cells which just won’t yield as easily to treatments. Lung cancers have a 50% chance of metastasising to the brain to cause secondary brain tumours, for this reason. All that carcinogen exposure has produced robust mutants which can seek out the best, and most deadly hiding places.

U mad bro?

In addition to all this, cancer cells are able to manipulate the healthy cells around them to make their environment favourable to live in. Some cancer cells can release chemicals which stimulate neighbouring non-cancer cells to release excess growth factors. Some cancer cells trick the immune system, so it doesn’t/can’t destroy them.

So, to surmise the extent of Cancer cell ingenuity

  • They switch on mechanisms to give them immortal genomes
  • They can seek out, and invade new environments in the body
  • They can manipulate healthy cells to help nurture cancer cells
  • They can switch off their natural death programmes
  • They can trick the immune system
  • They divert resources towards themselves

(This list isn’t exhaustive)

As a result, cancer cells are darn hard to fight. After all this, they are within our bodies, hiding amongst healthy cells. They are still kind of a part of us afterall. It’s why cancer therapies are so harsh. To kill the cancer cells, healthy cells also get affected. The disregulated mechanisms which give rise to these 6 characteristics are the prime targets for cancer therapies, but it does mean that some other cells will take a hit in the process.

I must iterate the point that cancer cells don’t have the ‘intent’ to kill, but exist as a product of darwinian selection. The production of their existence is as a blind consequence of a particular set of mutations, whose liklihood is either increased or decreased by environmental factors and lifestyle choices. Few things actually CAUSE cancer, as in - specifically switch cancer on as a product of their in vivo mechanics. Cells with this set of characteristics produce the cancer condition, because this is a convergant set of characteristics that allows a type of behaviour to persist - making cancer the devastating, horrendous condition that it is. Death is just a possible by-product of all this proliferation. These cells just have too much life - much to the expense of the life of the sufferer. And many people have been able to bear witness to that.

Too much life: 1

Picture from ‘The Hallmarks of Cancer’ by Hanahan and Weinberg, Cell, 2000

Cancer cells are normal cells, gone rogue. What’s so rogue about them? How are they ‘rogue’? There are 6 principle characteristics of cancer cells which differentiate them from the other cells in the body, and it is the presence of these characteristics which defines any given cell in the body as a cancerous cell.

1. Self sufficiency in growth signals

Self sufficiency from growth signals is a primary trait of cancer cells as cancer cells proliferate uncontrollably. Ordinarily, healthy cells need a signal to grow, from growth factors in the internal environment of the body (released from other cells in response to environmental and temporal cues to grow). Cancer cells are able to grow in the absence of growth factors, thus growing and dividing continuously.

2. Limitless replicative potential

Cells usually have a limit to their growth, due to the very nature of DNA replication. Cancer cells bypass this by making their genome immortal, so it isn’t damaged with every cellular replication - making a cancer cells ability to divide, limitless.

3. Insensitivity to anti-growth signals

Some signals tell a cell to stop growing. Cancer cells are desensitised to these enabling them to sustain their uncontrolled growth.

4. Sustained angiogenesis

Sustained angiogenesis is the ability of a cancer cell to switch on the growth of local blood vessels. If a cell is to be growing indefinitely, it’s gonna need a heck of an energy supply to meet this demand. Extra blood vessels increase the amount of oxygen and glucose available to allow this growth. The target of some current anti-cancer therapies is to inhibit angiogenesis, and it can be quite effective at halting tumour growth.

5. Evading apoptosis

Apoptosis is programmed cell death mechanism. Cells have an innate ability to kill themselves when the going gets tough. This is normal, natural and above all else, healthy. A cell senses it’s ill/mutated/not-needed so eliminates itself, thus alleviating its burden on the body. Cancer cells wouldn’t be very good if they apoptosed when their environment changed.

6. Tissue invasion and metastasis

Metastasis is the invasion of other parts of the body by cancer cells. Cancerous cells that can move around the body are devious and dastardly. If you remove one tumour, there may still be cancerous cells floating around in the blood stream blindly searching for a safer haven in which to nest and proliferate. It’s why tumour-removing surgeries are often only temporary resolutions to malignant cancers. Some metastatic cancer cells are still floating about the system, undetected, and they’ll flare up elsewhere - creating new cancerous growths, and disrtupting the bodily balance elsewhere. The safest haven for a cancer cell is perhaps the brain. Here, cancer cells are away from the brutal ravages of the systemic immune system, and also more protected from drugs (owing to the presence of the blood brain barrier, which excludes many substances to keep the brain safe from potential harmfuls). Metastatic cancer cells are what make a cancer malignant. Ultimately it is metastasis which is the most deadly characterisitic of a cancer cell (90% of cancer deaths are due to cancer metastasis). The other 5 characteristics enable a cancerous cell to form a benign tumour, which can be more easily controlled.

Yet another one of my two-part posts. Part two coming on the morrow, or there abouts.

Arrrg I be a virus

Viruses are intracellular parasites. That is to say that they need to live inside, and exploit a cell to maintain their own survival. In fact, they need to hijack a cell’s machinery in order to reproduce. In light of this semi-autonomous reproduction strategy, there is much debate as to whether viruses should be classified as living organisms, or whether they should be classified as a biological pathogen… thingy. Anyway, not the subject of this post.

Human Immunodeficiency Virus (HIV-1), a retrovirus

Viruses are basically large protein particles, with some genetic material encased within them, and a tiny amount of carbohydrates and lipid here and there. They can’t synthesise any of this themselves, so they inject or insert their own genome into their host cell, and rely on the already-present host cell enzymes to carry out the task of copying and transcribing the DNA, and turning the transcribed RNA into virus proteins. Some viruses can insert their own genome into their host genome. As in, physically stick it into their host genome so it’s part of the hosts chromosomes.

General virus life cycle

Whenever the cell divides, the daughter cells will all be virus factories too because the daughter cells will have been given viral DNA from the parent cell. The parent cell can’t always distinguish between viral DNA and its own DNA very well, so it copies all of DNA present. Viruses are freakishly devious, exploiting our own systems to enhance their survival. When a cell produces more viruses, the viruses will cause the cell to burst open, releasing viruses into the local environment to infect local cells. Sometimes, when a virus-under-construction is taking in its DNA before it sets off into the big wide world, it takes in a copy of some of its hosts DNA. The virus now has some extra DNA within it, which it will spread to the other cells it infects. This is a process known as gene piracy. Like accidentally making a pirate copy of a DVD…

Viral lysogeny - the process of a viral genome laying dormant in a cell while it divides.

An example of this is from Rous Sarcoma virus (RSV), which can cause cancer in chickens (some viruses are capable of inducing cancer, even in humans - eg. Human Papilloma Virus aka HPV. It’s why women should be entitled to the smear test. To see if they have this virus. Over 90% of cervical cancers have been linked to HPV). Early in the scientific research on this virus, scientists found a gene called src. This gene, when inserted into the host cell can trigger its transformation into a cancer cell. This is because the src gene codes for a enzyme which responds to growth factor signals and stimulates cell growth, but this viral-encoded enzyme remains switched on even in the absence of growth factors - so it’s constantly telling the cell to grow and multiply. Initially, some scientists were like ‘WE FOUND THE VIRAL CANCER GENE! HUZZAH!’ Well… not quite right.

The protein coded for by the src gene. It is a protein-Tyr kinase.

Turns out that the gene is already present in many animals, including humans - like without viral intervention. It codes for an almost identitical enzyme as the viral src, but this enzyme deactivates when it isn’t needed. What appears to have happened is that a non-cancerous form of the virus infected an animal in its early evolution, then picked up the standard src-gene via gene piracy. This gene mutated over the course of the viruses’ reproduction, and coded for a constantly activated enzyme instead - making the virus a cancer-inducing virus. Causing tumours would be advantageous for the virus as the host cell would undergo excess uncontrolled proliferation, causing more replication of virus particles. This particular type virus would be classified as a RNA tumour virus.

Viruses, hijacking the intracellular seas since….  before Jack Sparrow at least.

Life working against itself

It is a fact of biology that cells need to divide. One of the defining features of a system to qualify it as being living is the ability to replicate and reproduce. When tissues in our body grow, more cells are being produced to make this happen. I’m sure that’s not a massive revelation to many of you. However, as our cells divide and form defined tissues, they know when to stop. They sense when they’ve divided enough to form a fully funtioning, say, liver or something. It’s a good enough system, which enables multicellular organisms to exist.

The cell cycle

In order to grow, cells have many specific genes in their genome which control and regulate growth. These genes can be switched on and off, like most other genes, and are controlled by various environmental and intracellular factors. Some genes, when switched on, will tell a cell to stop dividing. This is normal, and all part of a healthy system which gives our organs and tissues defined shapes and characteristics. The processes of cell division and growth are collectively known as the cell cycle, and errors in the cell cycle can lead to cancer.

Cancer is an uncontrolled prolifieration of cells, where cells no longer have restrictions on their growth. They divide pretty much indefinitely. It is this growth which leads to tumour formation. Tumours are the end product of the release of inhibition of the cell cycle. Tumours are commonly divided into two types, benign and malignant.

  • Benign tumours are considered to be the ‘safe’ tumours, which aren’t life threatening. Benign tumours can grow indefinitely, but stay at their site of origin - they don’t spread around the body and seed tumours to grow elsewhere. Benign tumours are usually a uniform cell type.
  • Malignant tumours can be deadly. Malignant tumours also grow indefinitely, but can spread to other parts of the body (making them dangerous). The process of a tumour invading other parts of the body is known as metastasis. Malignant tumours can be full of different cell types as malignant tumour cells are capable of differentiation. The differentiation of cells is known as anaplasia.

It is important to note that cancer is not a ‘modern’ disease. We certainly notice it more now, and it certainly does have an increased prevalence now due to certain factors of our life style which I shall probe shortly - but it has been around for longer than there have been humans. Fossil evidence has shown dinosaurs with bone tumours. Or more recently in the geological time scale, ancient greek physician Hippocrates performed mastectomies on women with breast cancer.

Hippocrates

Cancer is a slow process. Tumours grow slowly. They certainly grow at a slower rate than most other tissues in the body. When somebody finds out they’ve got cancer, even if you say you’ve ‘caught it in the early stages’, that cancer has probably been hanging around for quite some time (and I don’t just mean a few weeks, either). It’s just not noticeable to begin with. 

Cells become cancerous when genes involved in regulating the cell cycle become mutated or damaged. Genes which control growth are called oncogenes. Onco- from the greek for ‘lump’. Study of cancer is ‘Oncology’ etc. Oncogenes (much like every other gene) can be damaged by certain viruses, UV light (from the sun - which is why sunbathing without skin cream greatly increases cancer risk), by various carcinogen chemicals such as benzene or benzoapyrene (these, amongst others, are flat planar molecules which cause DNA to be misread during replication, causing mutations to be formed), and high energy ionising radiation, such as that from entering a radioactive zone. Other genes whose damage is also involved in initiating cancer are tumour suppressor genes, whose role it is to ordinarily halt growth of a cell. 

A carcinogen is a substance which induces high-risk mutations in a cell, and as such can also be referred to as a mutagen. However, another way cancer can be initiated is via mutations in genes responsible for programmed cell death (apoptosis). Ultimately, cancer is an imbalance between processes controlling cell death and cell growth. Programmed cell death exists for a few reasons, but in this context it is there to remove any extra cells that just aren’t needed anymore. If the processes which control cell death are disrupted on a wide scale, then extra cells will continue to persist and tumours will gradually form. 

In fact, mutations don’t really need a mutagen to induce them. In order for a cell to divide, it needs to create a copy of it’s DNA so both subsequent cells have a genome. DNA replication is a relatively efficient process, and usually does the job. The protein machinery which replicates DNA isn’t 100% efficient and does make mistakes from time to time.

A single mutation cannot turn a cell cancerous, but rather an accumulation of mutations does. A minimum of 6 mutations, in different genes would be roughly the minimal amount of damage to turn a cell a cancerous. The probability for 6 of the right kind of mutations to occur in the right genes in a single cell cycle (a single cell division) is about 1 in 1,000,000,000,000,000,000,000,000,000,000,000,000,000,000. Of course, what could happen is a cell that divides a lot has a single mutation, passes it on to its progeny, and over a few generations it amasses enough mutations. The chances of this are much higher.  To this point, the most commonly occurring cancers occur in tissues with a high cell turnover rate. For this reason, guys should keep regular checks on their testicles, as loads of sperm are produced there everyday.

Testicular cancer

All in all, the overall chance of a cell becoming cancerous naturally is still about 1 in 100,000,000,000,000. And even by that point, a single cell turning cancerous won’t necessarily translate into full blow tumour formation. The body can recognise cancerous cells to a certain degree, and deal with them. Tumour formation is usually permitted by later stage immunocompromise and other factors. Of course, cancer is much more prevalent than these numbers would have us believe. That is because environmental (and other cellular) factors haven’t been considered. The natural background radiation from our cosmic environment (the sun and the universe!), pollution, the food we eat, volcanoes, industrial radiation and even our very own metabolism come in and increase the probability of mutations. Smoking and ionising radiation massively, massively increase the risk. Smoking releases high energy molecules and mutagens into the body, wreaking havoc with DNA. Ionising radiation physically interferes with the DNA itself, potentially changing the chemical composition of the base pairs that make up DNA. What the newspapers should be saying when they say ‘-gives you cancer’ is ‘raises your risk of developing cancer’ (here’s looking at you, Daily Mail, or Daily Fail as I like to call it)

Our own mitochondria release high energy molecules called free radicals which can interfere with DNA in similar ways to ionising radiation. Indeed, organisms with a high metabolism  (who therefore have more mitochondria per cell), such as mice and small birds, have shorter lives because the higher concentration of mitochondria inflict more damage  on their DNA (this doesn’t necessarily mean they all die of cancer, but it could lead to it - though they may have evolved systems to combat the cancer risk to compensate - I would imagine). This free radical damage is majorly implicated in contributing to the ageing process. Mitochondria are absolutely crucial to all multicellular life on Earth, as they are our power generators. But it’s also an evolutionary compromise to have them, as they’re liable to releasing harmful chemical species. Organisms do have systems in place to deal with radicals, and scientists have tried to utilise these to increase our health. Antioxidants anyone? They sequester radicals, and prevent harmful oxidation of DNA and proteins which contribute to ageing, and possibly cancer. It’s but one reason why vitamin C and vitamin E are so important.

Mitochondria in free radical production

 Cancer cells can be deadly, but are fascinating none the less. They behave completely differently to normal healthy cells, almost as if they have a mind of their own. They manipulate the body to make it ideal for them to survive, they have systems in place to enhance their own survival, avoid the immune system and to help them invade other tissues (something I’ll explore at a later point). They become rogue cells. Considering the factors, in reality, one can simply get cancer from sitting around trying to avoid the big world. The very processes that keep us alive can kill us through their own inefficiencies - though this chance is much smaller, than from say a smoker, a liquidator at Chernobyl, or someone who loves sunbeds or something.

Flick the switch

To say our DNA is our blueprint is only partially true. DNA is subject to the influence of various environmental factors, from the goings on in the cell, what food you eat, and the light from the sun. 

Eukaryotes, in all their diverse multicellular glory!

DNA is located in the nucleus of eukaryotic cells (the cells which compose all animals, plants, fungi and protists - but not bacteria or archaea). However, DNA does not simply float about freely in the nucleus. First, there are different chromosomes, so the nucleus will contain many distinct strands of DNA. Furthermore, DNA is packaged with proteins, to give it stability, and to enable the DNA to be controlled by the cell, and environmental factors. As you know, our DNA contains many genes, all encoding different proteins which define us as living, breathing organisms - enabling us to more than just survive, but to actually remain in existence as biological systems. 

DNA packing in the nucleus of a eukaryotic cell

The human genome is built up of some 25,000 protein coding genes (though, mark my words, there;s much more than just 25,000 types of protein in the body. But at that level, shit gets nauseatingly complex), and nearly every cell in the human body (or indeed any body, but let’s focus on mammals for the time-being), contains the same set of DNA (not including the gametes, but they’re special like that). Given this myriad genes with their respective phenotypes, how then, is it that a cone cell in the retina, and muscle fibre are two completely different cells, with massively different functions?

Same genes, different cell

My friends, allow me to introduce you to one of my favourite scientific concepts and disciplines - epigenetics. The idea that our genes are susceptible to environmental influence. And boy is this important. Epigenetics is a fundamental biological principle, which is only just being understood properly. The idea the certain genes can be switched on and off at certain times, in response to certain stimuli is the reason why multicellular organisms exist, and the reason organisms can adapt to change in their environment.

DNA strands are packaged by being wrapped around protein complexes called histones. The core of the histone is octameric (meaning it is made up of 8 individual protein subunits). A single Histone wrapped with its stretch of DNA is referred to as the nucleosome. DNA is wrapped around many histones, to form a beads on a strong conformation.This beads-on-a-string structure can then closely associate to tightly package the nucleosomes in a closed, solid (solenoid) structure. 

Hierarchy of chromosome structure

When in this tightly associated solenoid structure, the DNA is inaccessible to the transcription machinery which will produce RNA from the DNA blueprint, which is subsequently used to produce protein. So any genes locked in this solenoid structure are switched off. They are not expressed by that cell. DNA in in the ‘switched off’ solenoid conformation is referred to heterochromatin. (Chromatin is the DNA and proteins which compose chromosomes.) To switch a gene on, ‘transcription factors’ present in the cell respond to the appropriate environmental cue, and cause the heterochromatin to unpack. But how does this work?

Basic structure of DNA

DNA is a charged molecule. It has a negatively charged phosphate backbone. Histones contain a high content of positively charged amino acids on their surface. As you know, opposites attract, and the DNA associates closely to the histone. Also, histones associate with each other to form the solenoid heterochromatin via opposite charges on their constituent amino acids (as all proteins are made of amino acids, remember?). A family of transcription factors known as HAT’s (histone acetyl transferases) add an Acetyl group onto the charged amino acid. Acetyl groups are uncharged, and their addition neutralises the charge on the (usually basic) amino acid. This reduces the electrostatic attractions between chemical groups - and if this is done on a large enough scale, the solenoid heterchromatin disassociates to reveal the bead-on-a-string structure.

Plate i. describes the changes to the chemical composition to an amino acid in the histone protein. Plate ii. shows how this affects the structure of chromatin, thus leading to gene switching on or off.

The DNA will also bind less tightly to the histone as a result of Histone acetylation, and will thus be open for the big bulky transcritpion machinery to access, and do its job - causing protein expression from those genes. Other environmental stimuli may cause genes to switch off, so may activate HDAC’s (Histone Deacetylases). These remove the neutral groups and return the charge on the amino acids, thus causing reassociation of chromatin. 

There are many many many (many many) different transcription factors and HAT’s and HDAC’s which all respond to different stimuli, and add/remove their desired chemical group to different regions of the protein. Different environmental/cellular stimuli activate/deactivate different genes. It is in this way that the stem cells in the developing foetus become recognisable tissue. The local environment of a stem cell (so perhaps the chemicals secreted by other neurons in a foetal brain) causes the correct pattern of switches to be switched on and off  at a given time so the stem cell expresses all the right proteins to make up a neuron. The complexity of the inner machinations of the cell, with regards to genetic switches alone is nauseating - but truly beautiful. 

Understanding how this works is important in stem cell technology as producing stem cells merely becomes an act of some quirky reverse engineering. As comprehensive knowledge of how genetic switches work, can enable one to reprogram any cell, to cause it to revert back to a stem cell. One can then engineer an indefinite supply of stem cells in a lab, on demand. One needs to know which genes to switch off, and which to keep on - and in theory one can program any cell in the human body to become another. The implications of epigenetics are far reaching, and a better understanding of it will most certainly change the face of modern medicine as we know it.


Getting life right.

The above piece of artwork is by: Matt Forsyth

So I’ve noticed this picture going round Tumblr. It also popped up on the Tumblr radar, and at the current time of posting, I believe it has something upwards of 17,000 notes. I’m not surprised, actually, it’s an excellent piece of artwork, and all creative credit goes to the artist. I like it. If I wasn’t a massively indebted student (facing thousands of pounds of more debt) I might even consider buying a print of this piece. 

BUT. And yes, there is a big but. Not the nice kind, either. The reality is, I am a man of science. So naturally, I’ll have these annoying tendencies of pointing out mistakes when it isn’t really necessary. My qualm with this piece? The DNA is backwards! The DNA double helix we are all familiar with is actually what is referred to as being ‘Right handed’. It has nothing to do with dexterity, but rather, the positioning of the phosphate backbones.

‘DNA’ is short for Deoxyribonucleic Acid. It is the molecule of life. It is the genetic hardrive, storing hereditary information to provide a set of blue prints for the organism which will hopefully propogate this genetic blue print and carry on the genetic lineage. DNA is selfish like that. Us organisms are just vessels for DNA, so the DNA can survive and continue replicating. Different aspects of our biology are just different adaptations, or biological ‘tools’ which will prolong the existence of our set of genes in our particular template of DNA. It isn’t quite as clear as a set of instructions, mind. It’s more of a fuzzy set of guidlines, as the environment can change the way the genes are expressed, but perhaps I’ll delve into epigenetics another day.

DNA is a polymer of nucleotides. This means that many nucleotides all bond together to form a long chain. This chain, we call DNA. 

Here’s a quick scribble of the basic structure of the nucleotides that build up DNA. They all share the common sugar group. The name of which is Deoxyribose. It is called so as it is very similar to Ribose, but ribose looks somewhat like this:

And Deoxyribose, as you can see, is missing an -OH group (known as a Hydroxyl group). Missing an oxygen, hence it is De-Oxy. Gettit?

The big ‘P’ in the circle in my scribble denotes the phosphate group. This too, is common to all of the nucleotides which build up DNA. Phosphate groups comprise the phosphate backbone, once the nucleotides have all formed covalent bonds to form the DNA polymer.

Er yeah… I kinda took the above pic from ‘Biochemistry’ by Stryer et al, 6th Ed, 2006 (it’s the undergrad Biochemists’ bible). The highlighted red box (MS Paint ftw!) is the relevant image. As the caption says, the blue shows the phosphate group. The Red is the Deoxyribose sugar.

The last component to mention with regards to nucleotides is the actual ‘coding’ part of the DNA. Nitrogenous Organic Bases (NOBs), my A-Level Biology tutor taught me to call them. There are 4 bases in use in DNA. Different nucleotides can hold one of these 4 bases. In the long chain of nucleotides, there will be a sequence of bases. This sequence of bases is the genetic code which defines us

The structures of the 4 bases in DNA. Cytosine and Thymine are known as Pyrimidines and Adenine and Guanine are known as Purines.

As a result of these 4 bases, when reading genetic code, you may read something like …CCGAATGTGACCCCTGAGAGATGATTACAA… The bases form hydrogen bonds with other bases to form base pairs. This base pairing is what makes DNA double stranded (which gives it the ‘rungs of the ladder’ look).

Adenine can only pair with Thymine (in DNA). Guanine can only pair with Cytosine. This is due to the amount of Hydrogen bonds each base can form. Adenine and Thymine each can form 2 Hydrogen bonds, so will favourably pair with each other. Guanine and Cytosine can form 3 hydrogen bonds, so will preferably pair with each other.

So we end up with a molecule that looks somewhat like this. The 2 strands are antiparallel - each strand is extending in opposite directions, as is depicted by the ‘upside down’ drawing of one of the strands in the above image. This is important as DNA is read in a specific direction. It is read from the topmost exposed phosphate (referred to as 5’) to the bottom most -OH group of the last deoxyribose sugar in the DNA strand (referred to as 3’). You may also notice from the above diagram that the phosphate backbone carries negatively charged oxygen (denoted by the minus (-) symbol). For this reason, DNA is a negatively charged molecule, and this is very important in the formation of genetic switches, which govern epigenetics (must. resist. temptation. of. digressing. into. epigenetics…).

Due to the environment in the nucleus, and the sequence of bases, most DNA obtains a conformation known as B-DNA. B-DNA is the most common form of DNA, which is the standard DNA double helix one usually sees the images of.

From left to right: A-DNA, B-DNA, Z-DNA.

DNA is far from the uniform double helix we are all accustommed to seeing in the diagrams and pictures. DNA obtains different forms in different conditions of the nucleus, and different regions of the genome where the nucleic acid base pair composition is permissive for the DNA to take on a different form. At first glance it may just seem like pretty shapes, but the shapes seem to have functional or pathological significance.

To the far left of the above picture is A-DNA. A-DNA occurs in dehyrdated conditions. So a certain region of the nucleus may have less water in it, or the cell may be dehydrated. A-DNA is favoured by certain Bacteria in their sporing stages as when the spores bud off, they’re vulnerable to ultraviolet light. The A-DNA conformation protects the DNA from too much damage from UV light as pyramidine bases are spaced further apart, so they don’t form dimers and disrupt the genetic code. A-DNA is a fatter and shorter form of regular B-DNA (which is the most common form found in cells). The bases are thus spaced further apart, and will be less likely to dimerise in UV conditions. The specific bases that are within the DNA double helix are known as being hydrophobic. This means they don’t like water. In A-DNA, they are much more accessible as they are more exposed. This is because they aren’t being repelled by water in the low water conditions.

The middle structure is B-DNA. It is the most common form of DNA found in human DNA. This is the helix that is commonly drawn in diagrams and on signs and symbols. The distance between each base on the ‘rungs’ of the molecule is around 3.4nm (nanometres). The DNA has a width of 23.7nm.

Both A and B DNA spiral upwards in a right handed screw sense.

On the left, is a screw with a left handed screw sense, and on the right is a screw with a right handed screw sense. 

The structure on the far right is Z-DNA. It has a left handed screw sense. It is much thinner than B-DNA and A-DNA. It occurs in high salt concentrations and regions of DNA with a high alternating pyramdine/purine base composition. The positive ions from the salt associate with the negatively charged DNA phosphate ‘backbone’. This means the Backbone isn’t being repelled by its’ own negative charge as much, so it associates closer together, hence the thin structure. It got its’ name from the ‘zig-zag’ positioning of its bases. It is quite an unstable structure and can lead to chromosome breakage.

I just ripped this chunk-of-text quote from a previous post I wrote, some months back (in preparation for a genetics exam)… I know, it’s kinda lazy of me…

So, point in question, the DNA helix in the excellent piece of artwork at the beginning of this post is in the wrong screw sense, and can’t be Z-DNA as the number of Base pairs per turn are closer to what would be found in A or B-DNA. It should look like this:

There. NOW, it’s art! Just take it in…

The God of Trade

Those who make mirrors become palsied and asthmatic from handling mercury and liable to the other disorders mentioned above. At Venice on the island called Murano where huge mirrors are made, you may see these workmen gazing with reluctance and scowling at the reflection of their own sufferings in their mirrors and cursing the trade they have adopted.

Bernardino Ramazzini


In the quote, Bernardino Ramazzini, an Italian physician from the 17th century, was describing mercury poisoning in the trade of mirror making. Mercury can be highly neurotoxic, causing neuronal apoptosis (programmed cell suicide), and impairing development. It has a high affinity for sulphur, particularly when the mercury is in organic form. Mercury is usually converted into organic form by sea dwelling organisms, and can sequester in fish stocks.

Cysteine, a sulphur-containing amino acid. Proteins are composed of various amino acids.

Organic mercury will latch onto cysteine (a sulphur containing amino acid) in proteins and will cross the blood brain barrier in tow with a protein that would already cross the barrier (such as transferrin). Once in the brain, it can cause wide spread cerebral atrophy, apoptosis and necrosis. Cerebral damage tends to be worse in younger children as their blood brain barrier may still be developing, but sensory impairment still can occur in adults.

Image from ‘Mercury Exposure: Effects Across the Lifespan’ by K. Taber et al, 2008, J Neuropsychiatry Clin Neuroscience

Brain slice from a man who was exposed to mercury from eating a contaminated pig at the age of 8. After months of organic mercury (organic mercury is much more toxic than inorganic mercury) exposure from eating contaminated food, the child grew up suffering from blindness, being mute, quadriparesis (weakness of all four limbs), choreoathetosis (involuntary movements, writhing and contractions) and seizures. The child grew up to the age of 29 years before death.

Mercury attaches to sulphur, which is in proteins (through cysteine and methionine amino acid residues). This can alter the function of enzymes within cells, causing cellular dysfunction. Mercury also initiates the apoptotic cascade, causing programmed cell death. Mercury within cells can increase production of free radicals (highly reactive chemical species which will react with anything and everything) which can damage DNA and proteins, also leading to apoptosis, or even necrosis (which is just the cell dying and bursting, unlike apoptosis which is programmed and controlled death). It also interferes with the cell cytoskeleton and its formation. With this occurring in the brain, widespread neuronal death will occur. The limited capacity for the nervous system to regenerate means that the nervous system is hit particularly hard by organic mercury toxicity. Mercury disrupts cellular function in many different ways, which contributes to its high level of toxicity. It comes as no surprise really, that it can induce such widespread cerebral atrophy, and cause the effects Bernardino Ramazzini described.

Genetic interference

A diagnosis of genetic illness has always been seen as a damning one. There’s a problem with the very code that defines you. We’re still far from actually opening up our DNA and physically correcting the mistake, however, one can interfere with way the genetic code is turned into an actual physical characteristic. There are many steps before the code in the DNA is translated to the protein which gives rise to the physical characteristic.

DNA is like the hard drive where information about the structure of the organism is stored. It is stored in a compartment of the cell called the nucleus.The code needs to be translated from storage nucleic acid form, to proteins, cells and organised structure. To achieve this, enzymes read the DNA and use the code in the DNA to construct RNA. RNA is single stranded and travels out of the nucleus where it docks with ribosomes in the endoplasmic reticulum and cytosol of the cell. The ribosomes are where the code in the RNA is read, and is translated into protein form.

DNA -> RNA = transcription

RNA -> Protein = translation

The central dogma of Biology

 It is in this way that DNA is the molecule of life. But without RNA, DNA is pretty useless. In fact, some viruses have RNA as their genome, instead of DNA.

There are many different types of RNA which carry out varying functions, but the RNA involved in converting the DNA code into protein is mRNA. 

mRNA is chemically similar to DNA, and copies the DNA code from which it is transcribed, but carries it in a form that can be read to produce protein.

  1. mRNA is single stranded, unlike DNA
  2. mRNA is unstable and has a short half life

Proteins are what build us up. Our functionality, our structure, relies on proteins. Proteins are the molecular structural and functional components of all known living organisms (no exceptions). 

A gene is a stretch of DNA that codes for a single protein. There are some non coding genes which have a regulatory role, but let’s not complicate the picture just yet. So by mutating a gene, you are disrupting the information that encodes a protein. The subsequent protein may be non functional, faulty or may not even be produced. Different proteins do different jobs, and affecting a single one can have a knock effect. Some mutations won’t do anything. Some will have a minor effect. Some will have a major effect. Some may not allow a foetus to be viable. 

Note how DNA is double stranded - giving it a ladder shape.

 Many genetic diseases cause over production of a protein, or production of a faulty protein. And this excess leads to the widescale pathology. One aetiology of Alzheimers is thought to be faulty Amyloid precursor protein. Huntington’s disease arises from a mutation in the gene coding for huntingtin. Cystic Fibrosis causes production of too much mucus.

Cells have many mechanisms to regulate protein production, as protein levels need to be tightly controlled. DOn’t want too much or too little of a protein. One method of controlling protein production is from the those non coding stretches of DNA Imentioned earlier. Some of them code for RNA which itself is functional. This is known as micro RNA, or miRNA.

(Some extra info if you’re interested: miRNA, once transcribed folds on itself to form a hairpin structure. THis is then transported out of the nucleus, and is recognised by Dicer protein which removes the hairpin loop leaving just a doube strand. RISC protein comes along and degrades one strand, the other strand attaches to the RISC and is used as a template to seek the specific 3’UTR on the specific mRNA which is to be degraded.)

The miRNA binds to to a region of the protein coding mRNA called the 3’ UTR (The 3’UTR is a regulatory region on the mRNA). This forms a small region of double stranded RNA which is detected by a RISC protein which then chops up the whole RNA complex, thus reducing the levels of mRNA for that particular protein, meaning less of that protein is produced. 

If we can understand the structures of the mRNA’s that code for these rogue proteins (which we do), then we can engineer our own miRNA’s for whichever proteins we want. If we can then administer these exogenous miRNA to a person suffering from a genetic disease, we can keep the faulty genes in check and make sure they have a minimal impact. As we have two copies of every chromosome, the chances are the other chromosome will have a healthy version of the gene which can compensate and produce the correct protein.

Mutations aren’t usually this cool


This miRNA therapy has far reaching implications for treating a whole host of problems. It can be used to treat AIDs to prevent the proliferation of HIV by preventing our own cells from producing viral proteins. Hell, it could treat pretty much every viral infection. It could treat pretty much anything. But, more reseach needs to be done to produce better miRNA’s and more importantly, an effective delivery system for the miRNA. Most RNA is unstable, and degrades rapidly. THe environment of the blood is completely hostile to any kind of RNA so injection of an miRNA solution would be useless. Scientists are looking towards manipulation specifically engineered viruses which would carry the miRNA instead of harmful viral DNA, and these viruses could target specific cells and inject the miRNA where it is needed. 

Well, it sounds like a very promising new frontier in medicine, and if refined, many of todays devastating diseases could be effectively controlled (including cancer). Granted, it isn’t a cure, but it’s as close we’ll get in the near future. Oh yeah, another problem is probably money. I can imagine it won’t be cheap once they refine a delivery method. Alas, big business, can’t live with it, can’t live without it…

A fortress of intelligence

The brain is a fragile, energetically demanding and crucial organ. It’s not quite as robust as the rest of the organs in the body. Furthermore, it has a delicate chemical balance of amino acids, neurotransmitters and ions to maintain so the impulses (action potentials) can be fired and propagated effectively, so the brain can process and analyse information, as well as send outputs to the rest of the body. The brain needs added protection. What does it need protecting from? Foreign pathogens, and unwanted chemicals. And how would they normally get to a healthy brain? Through the blood, of course.

Which brings us onto our first line of defence for the brain. The brain is defended by the Blood-Brain Barrier (BBB). Nearly all of the blood vessels in the brain are modified, to make it that much harder for substances and cells to cross into the brain. A normal blood capillary is slightly porous, to allow certain proteins and carbohydrates to pass through into the surrounding tissues.

Diagram of capillary

 The BBB doesn’t have this. There are tight, protein junctions between the endothelial cells which constitute the capillary wall. Past this, there is a space, the exact use of which is poorly understood, known as the Virchow Robin Space. Then there is a protein basement membrane surrounding the capillary. Aside from this, there are types of glial cells such as pericytes and astrocytes which also monitor the environment, and regulate the blood flow.

Cross section of a cerebral capillary. This is the structure of the blood brain barrier. The blood brain barrrier is not a distinct organ, but rather, is a functional concept.

Within the endothelial cells constituting the cerebral capillaries are special efflux transporters which detect unwanted substances and then transport back them out of the endothelia, into the blood. There are also enzymes present, ready to breakdown unwanted substances. In fact, the BBB is pretty much built to exclude all proteins, carbohydrates and large molecules (most gases pass by just fine, if they can dissolve in the blood well enough etc). There are special proteins which are transporters. Their job is to transport glucose and other important substances (vital amino acids) into the brain. We utilise this to deliver drugs to the brain, as most drugs are excluded by the BBB. Patients with Parkinson’s disease require Dopamine treatment, as they have dopamine deficiency in the Striatal region of the brain (due to degeneration of the neurons of the substantia nigra). So instead of providing dopamine in drug form (as dopamine cannot cross the BBB), they are given L-DOPA which is a precursor to Dopamine. L-DOPA is accepted by the transporters (L-DOPA is transported by LAT-1 and LAT-2 proteins) and transported across the BBB. Once L-DOPA has crossed the BBB, the appropriate neurons will metabolise the L-DOPA into dopamine, and the Dopamine is replenished, helping to treat the symptoms of Parkinson’s disease.

The essential amino acids which cannot be produced in the brain must also be transported in. These are Phenylalanine, Isoleucine, Leucine, Threonine, Histidine, Tyrosine, Tryptophan, Methionine and Valine. I remember them by their official single letter abbreviations, which I arrange to form the accronym -

F I L T H Y  W M V

Yes, a crude pornographic satire there. It works though. The endothelial cells also are able to endocytose particular proteins, if need be.

It is through this that the brain is able to withstand infectious insult. When the rest of the body falls ill with something, the brain is usually relatively safe as a result of the BBB. However, the brain is exposed to pathogens through regions of the brain which don’t have BBB (out of necessity). These regions are known as circumventricular regions. There are 7 circumventricular regions in the brain.

(the subcommisural organ is not labelled) These regions lack BBB as they either need to sense substances in the blood stream, or need to release substances into tbe blood stream. For example, the Area Postrema is the ‘vomitting centre’ of the brain. It detects noxious chemicals in the blood, and then can trigger the vomitting reflex (emesis). The Posterior pituitary is responsible for releasing vital hormones into the blood.

If the brain is a victim to insult, or is damaged - then the systemic immune system will have trouble initially infiltrating (it does eventually). Microglia are the resident immune cells of the brain. They are usually in a dormant state, where they are stationary, but send out processes to scan the local environment for chemicals indicative of noxious insult or infection. When they do detect cell death, injury or infection, they activate and migrate to the offending site to release inflammatory agents and neuroprotective factors. If the neurons die, then microglia morph into a phagoyctic state, where they are capable of engulfing debris and digesting it. Glia are truly amazing cells, and get very little attention. Indeed, glia make up 90% of our brain cell count. In some cases, microglia work against us (though they mean well). They release inflammatory agents… but the brain is fragile and doesn’t cope well with inflammation. Inflammation of the brain is known as encephalitis. So if a microglial cell detects an invader (eg, Toxoplasma gondii), it try to initiate inflammation, but this just adds to the problem as the ionic balance of the neurons is disrupted, the neurons don’t work properly and eventually they die. Encephalitis is nasty, and usually fatal. One reason the brain wants to stave off infection with the BBB. As cerebral infection progresses, the BBB does open up to leukocytes and other cells of the systemic immune system.

Diagram of Microglial function

The brain is such an important organ, it literally defines ‘us’ as who we are. It is the generator of consciousness and so much more - yet it is extremely fragile and exists in a fine balance between functionality and degeneration. And when the maintenence systems go wrong, we see conditions such as Alzheimer’s, encephalitis and even meningitis. It also highlights the fallibility of the human body, and why we shouldn’t take our lives for granted, and just be happy for waking up in the morning in one piece. Sometimes I wonder, what with all the thousands of systems in place keeping us alive, and the sheer number of things that go wrong, how the hell do I get through the day?

We can rebuild him. We have the biology. Kind of.

Hi guyseessessses…ses. Haven’t posted in a few days, I feel like my page may have atrophied from lack of use as it’s been a busy few days - well most days are busy. This degree isn’t going to do itself afterall. Anywho, I’ve been recapping nerve regrowth for neuropathology and neurotoxicology class and I’ve reminded myself how interesting I found this topic. So here you go.

I’ve got me some skate protection so I don’t have any falls that may cause me nerve damage. The ground had better watch out. Get me.

To understand nerve regrowth in the periphery (arms, legs, trunk etc) it is important to understand the basic structure of a typical peripheral neuron.

 

One end of the peripheral neuron will be in the spinal cord. In the case of the motor neuron (cell A), the cell body (aka the soma) will be in the spinal cord in the ventral horn. The Sensory neuron (cell B) will have its’ soma in the dorsal root ganglion of the spinal cord region, but will have its axon and terminal in the dorsal horn of the spinal cord. It also important to note that the peripheral nerve axons are insulated by individual schwann cells which wrap themselves around the axon. These form the insulating myelin sheath whose main purpose is to increase the speed of nervous impulse (action potential) conduction. They also have other functions, such as providing nutrients and support for the axon.

General structure of the spinal cord. Important aspects are the dorsal/ventral horns and dorsal root ganglia.

 When a peripheral nerve is damaged by either crush or severance, it has the capacity to regrow and repair. Initially, The damage cuts the axon in two or at least damages the continuity of the axon. This is followed by degeneration of the distal (downstream from cell body) region of the axon as it is no longer receiving chemical input from the cell body. The transport of substances down an axon, away from the cell body is known as anterograde transport. Lack of important nutrients, proteins and signals from the cell body causes the isolated region of axon to die.

 The region of muscle being innervated by the neuron/s involved in the accident now isn’t being stimulated. When neurons fire on a gland or muscle (the effector), they also release factors which support the growth of the effector. Lack of firing from nerves causes the effector to atrophy. It shrinks and wastes away. This is why most of us can’t wiggle our ears. Some people train themselves to do so from a young age and thus stimulate muscle growth. Most of us don’t so those muscles atrophy and become of no use.

 Anyway, the Schwann cells forming the myelin sheath around the severed region of axon begin to dedifferentiate and merge to form a hollow tube. The dead axon is cleared up by macrophages and other immune cells. This leaves a hollow myelin tunnel which secretes growth factors and chemoattractants. The axon stump is stimulate to regrow by this and begins to grow towards the chemoattractants.

Above, a diagram depicting stages of wallerian degeneration after nerve serverance, followed by regrowth of axons. The cells around the peripheral nerve axon are schwann cells. In the second stage on the diagram, macrophages have invaded the severed nerve region and have cleaned up the dead region of axon. The big black blobs are axon growth cones which seek out chemoattractants to grow towards and revert from chemorepellents to grow away from. The shape at the end of the axons is the muscle, with the shaded regions showng the pattern of muscle fibre innervation. As you can see, the pattern of muscle control has changed due to incorrect rewiring of the nerve. Ah nature, your imperfections intrigue me so.

  Now, it’s rare that nerve damage will affect a single axon, as peripheral nerves are bundles of neurons, and each neuron innervates different muscle fibres making up the total muscle. Multiple myelin tubes releasing chemoattractants can be confusing for the regrowing axons as they all release pretty much the same signal. The axons will grow where the signal is strongest, which means rewiring can be faulty as different axons enter different myelin tubes from their original. This means they’ll end up innervating a different region of muscle. As a result, your reflexes become weird as your muscle will move differently in response to the same central command. Then you need to retrain your reflexes and relearn how to use that muscle properly (it’s not as much of a hassle if it’s a gland).

Diagram depicting general structure of a nerve.

 Now the central nervous system doesn’t work this way, as the myelination is carried out by oligodendrocytes as opposed to Schwann cells. A single oligodendrocyte can myelinate hundreds of axons. These oligodendrocytes also release different chemicals which actually inhibit nerve regrowth. Seems like a weird system to have. The presence of glia in the nervous system also has a role to play in central nervous system regrowth/inhibition. Glia are the other cells found in the nervous system aside from neurons.

Diagram of an Oligodendrocyte

There are many different types of glia and they carry out many vital functions. There are at least 10 times more glia in your brain than there are neurons. They are crucial to maintaining neurons, acting as an immune system, helping memory formation and so much more. Outside of the field of neuroscience, most people don’t seem to pay much attention to these critical cells and it’s only been in recent times that other people have been taking them seriously.

Astrocytes are a common type of glial cell. They have multiple functions that are vital to survival of the CNS, and one of their functions is to help maintain the CNS. When a region of spinal cord is severed, the astrocytes make it almost physically impossible to regrow axons in the severed region as they form what is known as an astroglial scar. This scar was presumably advantageous to prevent any damaging chemicals released from a necrotic cell from advancing through the nervous system. It forms a protein plug in the space left by the severance which physically stops axon regrowth, as well as releasing inhibitory factors. There are other reasons why spinal nerve damage is so hard to repair, but that’ll take a long time to explain and you’ve probably got much more important things to be getting on with.

Picture a) shows astroglial scar formation. Picture b) shows a possible treatment for overcoming astroglial scar and encouraging regrowth of spinal axons.

Finally, the brain. If regions of the brain die (due to stroke etc) the brain doesn’t usually regrow neurons to any significant extent (though there is some regrowth, the rate of neurogenesis rises sharply after a stroke, but then falls again. Scientists are trying to find a way of utilising this to reverse the effects of major stroke). However, other regions of the brain can form new connections (synapses) and sort of rewire to function differently and compensate for the lost brain region. It’s a pretty far out mechanism that I don’t fully understand just yet but perhaps other people do. Perhaps they don’t know, but understanding how this works will be a major advance in neuroscience as drugs and treatments could be used to target and enhance this process so as to increase the period of recovery from major brain injury and ensure quality of life and survival rates improve. At the end of the day, it’s all about survival.